Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs311 ]


Position: chr1:63,369,349-63,370,894 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ATG4C - LINC00466

Expression Pattern
neural tube (5 out of 5 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5


Fasta sequence
GCTCCCCAGCGTAATGTTTACTTCCATGGTCTCTGAGACCTCGGTGTGTG
GCTGACTGAGGTGTGTGTGCACTGGCACGGAGCAGGGGTCACTCGCTGTC
CATTTTAAGGGCTCATTTCTCAGCGGGCCCTAAATAATGGTAGATTGTGT
TCGTATTGTCGTTTCTCCTGATGTATAGATGGACGCATACATATATATGT
GTACATATATATATTTTTTACCAGCTGAGCATTTCTGGAGCCTTGACCCT
TTCATTTTAGCTTTACCTTTCTTTGTCCCCTGAATGACCGGCATAATTCA
TCTGATTATCTATTATCTTGTTATTGGACATAAATTTTACAAGCTGTTGA
GAGTGCGGAAAATCAATACCTTTTAAATGCTGTTTATGTGTGATTAACGG
TTAATATCCTCACAAATTATTTAATGTAATAAGGTCATTTATCTTTTGCA
TGGGCTTGGTATCCTGCAAAGAATAATAGAATAATAAATGAGGACACTGG
TAAAGAGGATATTTCAGATGCTTTTCTGTGCCAGTTTTATTACCCATATC
CTCTTTACAGCCACAAAGCTGCACTATGGTTATTTTATGCAAGTAATAAA
ATTAGCCTGAGATGGAATTAGCAGACTCGGGGCTCTTTATAGGTCAAGTC
GGTGCTTTATGAGCCTGCGACTCCCTAGTGCTATCGTCATGAGGCTAGTT
AGAGGGGTCTTTAAGCATGATTTAATATGTCCATGCTTCAGAAAATAGTT
AAATAGCTAATTAAATGGAGGAGTTAATTTACATATTAATTGACCTTCCA
GTAATATTTATATTGATACCTACATGAGAAGCTCGTGTCTTCATTGCCTT
TCATCATAGTTAGTCTGAGCAAATATGGTGGAACTTTTTTGTTTAAACTG
AAGTTTCTCTTTATTGTCACAGGAGGGTTGTTGTATTCCCTGGAATAGTG
GAGTACATCTGGCCTCGCATTTATGCATTTGCAGAAGCCTTTTGTTGTAG
AATAATTAGGAAACACAGTCAAATATGCAAAGGGTGGTGTGAGTGTGTGT
GGGGGGGTGTGAGTGTGTGTGTGTGTGTGTGTGTAAGGGGGGTGGTTACA
TTCTTGGATCTTTGCCTGAATAAAAGCTGGTGATAATTATGATAATCATG
GTTCTTCAGTCTAGAAGTCCTTTGGGAGATAATATTGTGGCCATGTGTTG
AAATTAGCATAACATTTTACCTGCAGTTATGAGGGAATATTATCAACTCA
AAACCTTCAAGTAGTAAAAGAATGGCTTATGAAGGGAAAAAGCACCAGAG
AGTTATGGGTTTAACAAATACAGTTGAAGCAAGCAGCTGTGTGCAGATCT
TGCTTCCAGCCTCGCACAATGTATCATGAGAGAATACTGCCGTCTGCCCA
TTTACTTCTCTTCCTTTAATCAGAGAATCATCTTTAATAACTGAGGAGTG
TTTTAATGTACTAAGCCTGCTGTTTTAGTGTGCGGCATCTCTATTTACAA
CAGGAAATGCTCCGGGAACACCTTCTCCTCGTGCTGCTGAGTTTAG
Primer
(+)GCTCCCCAGCGTAATGTTTA
(+)TAAACTCAGCAGCACGAGGA