Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs282 ]


Position: chr6:98,116,085-98,116,943 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC101927314(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
hindbrain (rhombencephalon) (6 out of 8 embryos) 
midbrain (mesencephalon) (6 out of 8 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5

Fasta sequence
ttCCATGGAAGCCTTGGCCTTTTAagatagataacaaaatagtagtaaatattatcatta
ggtaaaaaaggggacggctctgtgccttggatatctgtagtaggaccattatcattgtag
gaatgtgttgagagaagctattggcatgctaaaaatacactactttaataataatccatg
cataaaggaccaagagagaagatatggcagagaactaatgaattctggatcttttccata
tttaccatttccaccaaaaaaattaaatgccgaatattaaattataatgtttaaacataa
aaagtgaaatctgtaatgttaaaatgaacttgaatcatgtaaatgttaaatttttattta
aaatgcgtctcattttatttatattcaaaacagatgcatgattttaaatacagggcggtt
gtaatattctaagcacatattttagggacttcctcccttttccaaatctcactcaagtgg
aacatacactcatttctgtaacaaaaattctttctactctattggcaaaatgaatagcat
caactcaaaatatttaaaaatttagtcacatccacatcctgcagcctataaggagctttc
acgcttttgggctcgctttagatctttaataccctttccttttgtgtcaaggagctcacg
aggcgtaaagaagcactgataaacccacttagatcccttcctgggccgtcacctctcgct
gccaagcggctttaggtggtaactgatctgtgacaggctgccagtcaaacagagcatttc
tgaaagctgacacaaaagactgaacgctggagaatggataggaaaaataagaaaaggacC
CAAACTGTATCAGTGCCCC
Primer
(+)CACCATGGAAGCCTTGGCCTTTTA
(+)GGGGCACTGATACAGTTTGG