Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs280 ]


Position: chr1:44,989,824-44,991,149 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: RNF220(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
limb (4 out of 4 embryos) 

Embryo 1

Embryo 2

Embryo 3

Embryo 4

Fasta sequence
CctCTCAGCAAGGGCTCGTAAAGctgcaggtgtgagatgttgttatttagtctagagcct
ggtatgtgacagcccgggccctctctcctgcgaactgccgccgccaccgcctctgctggc
cagataattagtccattacgactctcccacctcgggtaggtgggggcagggtgagagccc
accctcagactccttgtaattcaacttcctgtgttttatggaagcaggctgttgggggca
gagagtgaaaggccggtccctaggcttggccaaccccttcctcaactcccagcccccacc
tccctccttccacccaaacccggttgctgtggtgaccaaatgttatttcccagcttcgtg
ttggaactgctttgtaaaagttttttacatctcttacctgcctcaaacacgaatgcaggc
tggtctatctctccctgcgtcttgctctgcccgtctcttcctccgcatctctcctctgtc
tctctctatttttattacacgcttatcgcctttttccctcctgcttttgaaattgatttc
ctttcctttctccccctattcaggacctaaacgctgaatgttcgatatttcatttgagac
cgctaatcgcattactgcccttgacgttttacagatatcatattatgggcgcaaatttgg
caaattattagcgctgtaatgtatagcttgtcagaggtatttaagacgctaagagcccaa
ggcttatcggggttagcagagagctctcgttgagcttttgaaatgcagagagccagttat
aaaacacactgtgactctctcttcagctggtgaaaaaaaggaaaagagaaaaagagaaag
aaaaagaaaaaaaatgtcacccgtctatcagaggcttccagggctgataacaagcaaaat
tcttctctgtgggtttcactggaaatgtgagaagcttttaaaacatttctcaagctgtct
ggaaaagaaaaaaaatctttattgaaaggatgtagcaatcttttttactgtggcctattt
atctctggggaaaaagctgtaacaagaagatcccctactggtcaccagccgtgtcagggc
ctgcctggctttggtgccaggactttggtgtggggggcttgctgagcgagaggggggcca
cctttggcaaaacggggaaaggctgctggctggtgtgcattcctgtggaagaggcagcgt
cctgcacgcctagcacagcgctcagggctcagcagacgcatctcatcaaatcctttttga
atgaatggttgaatgaaccaaccaacaaacacacacaaaaaataacAGAACCTTGAAACT
GCTGCC
Primer
(+)CACCTCAGCAAGGGCTCGTAAAG
(+)GGCAGCAGTTTCAAGGTTCT