Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs27 ]


Position: chr16:55,079,237-55,080,429 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: IRX5 - IRX6

Timepoints:
e11.5

Publications:
These transgenics are embryonic day 12.5

Expression Pattern
eye (4 out of 6 embryos) 
limb (4 out of 6 embryos) 

Embryo 1

Embryo 2

Embryo 3


Embryo 6


Fasta sequence
TTTTTACTGGTCCTCCTCCAATTCTtactactctggatcccagggggcagagcccaggta
cctccaggccctctgctctccatgttggaaaggggccggaggaatagtgcaatgctctat
gggggaagacgctcttcccagggggttcccctgggatcttcaccggggctgtggcatggg
gcctgttgttctggggaagccaaagctagtgtctgctcagaaaagggagcatgatggtcc
cacagggtagctgatggaacctcctgctgtaggtttgcaagggctggatgaagattggga
aacagttccctaacagggaccataatgagactgcaagatacagagggagtcccacagcat
aaataggccaacacatttgttcatttctccttcttgaaatttcctttgcaatatccgccc
ccacccctcaaaatgggaaaaattgtaaaaaatgataaattggggttttgtgtgtgtgtc
ttgttttaaaccaatatgatctcaattcttttgtgggctttgaaagtccgtgcgggaatt
cccccctcgctgtaaatacccagcgtccgggccttatggcatgtgatctgtaataaactt
caaaagaacacctttgacattttagataacttgcaaatgatgatgcagagagatcttttg
ccactacaaagaaagaacaaaagaaccgacatgaaagagaaatcaataaacatatggcaa
ttaataaaacattttctatgaataccctacaaagagttttacaacagtataaaaacccaa
cagttgtttcaatgtggatttaagaagtctcagctggcgtattaaggcatccgtgctgag
cagcacacgggaaggcccagaaaaactggggccaagtctgggcttgtaaatccatcagag
ggagaggtatagatcagatggatagttggactggaaaggggccggaggaatggagcaatg
tattcctgtttcagggactaaaaatgcaaggtgggaaccactggtgaacacacccgtttg
gaagttgggctgggtccctgcaacctcatcagctaagccaaggtacagtcacattctcag
agatgggctctgtagcatgcccagagacttccagcttctccatgtccaatctctgccagc
tttcaattgtgtccagcctggggccacaGTGAGATTCAGTACGTGGAGGTTTT
Primer
(+)tttttactggtcctcctccaattct
(+)aaaacctccacgtactgaatctcac