Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs26 ]


Position: chr16:55,223,185-55,224,283 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: IRX5 - IRX6

Timepoints:
e11.5

Publications:

Expression Pattern
eye (3 out of 7 embryos) 
midbrain (mesencephalon) (3 out of 7 embryos) 
neural tube (3 out of 7 embryos) 

Embryo 1


Embryo 2



Fasta sequence
TTCTACTTCACCAGACCTTCGAAATgctggggtgagagcctctggagctcatgctcccca
tgtcatgatgaaggcagctttaatggctttgagtcacgtgcccctcaaaggccagccccc
cggacagctgtttgcaaactcctctccaaagcagcttcccttgaagagagttgctacaca
atcattacaaattgattgcaaaagagctaacaatcatgattaaatcattaaattcttgtc
tacgcttcagagagcggtgagaaaattaacttcccaccaacctaattttttcctgaacat
gaaataatgattttctgcccgtctaattacaaagccaacatctgatcaagccagcatcca
gaggggattatcgcatgcacgagtattagacctcattaccagcttgagtgcaaaattatt
acatcttgtaattggatggtgagatttatatacagatcggcccggtttctgtaagattgt
aattacaagcttcgttggttagctacttatcactcagcacagaagagaggaaaataagca
acagaaaaggcatttcattaacccataaccctatcaagggaaagccactgtaacacccat
gtctgcattagggagaacagctaaattcacagatgaaacaatttattatactctttgcaa
atgggattgcattttgtttaacccctaatgaactctttgggtaaagtgtctgaacaaacc
attcattttatagacaactaggttcaatacagtaattataaggggtaactgactgagata
aatgctcacctgcttagaggctgttgattagaggcacaattgctgggcgctgggctccgg
cacaaagggccggggggctggaacagccttggatttcccggggagctgctgggggggcag
caggaccccgcatagcaaatctactctgcactcggaacgctaggcattcgttgtcaagcc
tggctggaacaggcgaggtttaataaagccgcaagggcgatgcagtttaacaattttaga
ggcactggtgtggaacgcagaaatttcaatatagcctgatgaaggctcctcacaTGCTCC
AGATGTGTGACCTAAATTA
Primer
(+)ttctacttcaccagaccttcgaaat
(+)taatttaggtcacacatctggagca