Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs248 ]


Position: chr2:177,503,157-177,503,671 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC102724224(intragenic)

Expression Pattern
nose (7 out of 8 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 6

Embryo 7


Fasta sequence
GGAGCTCTCGTCTGTAATcagcacatttatccacatttaagggggaaaatccgaattaaa
tccccgtgaccctgattgggttacagtgtcattttccctggatcctcttttaaatccact
ccacactgcttctctgtctattacatgctaatttaattttactgtggaagatattttcag
gatttgctgaggacagtaaattttgtagtttatgttatttcactttttatgactttttaa
cacttaataaaattttattagagcacttttgtgtttacaaggccacaaaactcttggcag
gttgtcagaagtcctttttattatgatcctactgatatactgcgagtaatgaaataatca
tgtccagaaatgtatcaaaggccagagggattatcccacttaatagctccacagatgcgc
ccagaagaatgtggacgcgcgacaggacgggctgaaaggctgcaggaggaagcaggcagc
cccggctcctggcttTACCATTTCGGTTGCTTTCC
Primer
(+)GGAGCTCTCGTCTGTAAT
(+)GGAAAGCAACCGAAATGGTA