Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs243 ]


Position: chr2:174,985,544-174,987,464 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: OLA1(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
limb (9 out of 10 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5


Fasta sequence
tcttGTGGCCAAAGTCACAAACCTctcctctcctctttcttgatggtttaaaatagtttt
ccagatctaaaagacccatgaaagtatttattactgtttcctgcatcagtcttatttgct
atagtaacattacatgttaatcttaaaaaacaaaaactttttcttttgctaaagaagcaa
ctaataatgcaaatggagcttagatgtaaacattaccaaaaaacaagatgctaacacaat
taaaaggatttagtagttaaaatggattttaactatttacatctgctttcagtgttataa
atgatgaaaacctagtgttcatatccctcataataaaaatttattctgcactttaataca
aaggctatgttgcataaacagagaggatttaaagctgtagcagagtggctgaatgaaagg
aaaatggcaatctttctggctccagtagatgccattccctatcacacaatatttcccact
cataaatatatgacaaatacttcctcaatcattttttacgagcagggatgcacagggggt
agtcaatggctagcttgagggaaaataggaacagcaggcggcagaaactgtacagaaaat
ggctatgtggtaaattctcttctggaacatcattcagttacccagtctttgatctttcag
ctacaattacactaacttccacaagatctggatccctcccaaccctccccccaagacata
cacacaccaaccccaagccagatcattagttatacataaaacctattaagatttggtttt
ataaaataggatcattcatacctctacattattataaattaaaatttgctatttagacaa
gggtttactttcaattggctataaccatgtcatcatcacaactggtctcacaaaaaacat
ggggtgtctggcgacagctaaatcacagactggcgtctcctaagcagtctgtctaccatt
agggtctgggaaatggtatttactatacaattagagccagggagttctacctgtaatcat
ccaaatacaggtgtgagaagtccctttgggcaaggaaactgactcatcccttttcatgta
aactttgatgtctgtattgtttcacagagcctcaggaaaccttaccattcataccacaat
gagaagatttattaactgaggtcaagtaataaattttaaaattcattcctaaaggtaaca
atttttaacacattaatcatcaaatttataagaatttgaaaggcgacagaactgattatt
ttaaagttaattacctgatggaggatactgaccagctgaatgaaatctttatgttaaatt
tatgctttttagaacattaccaataaagaggctaaattcatcttcctatcaggaacacaa
aatgtcttatagtaatatcaacagggcatttttagttgcagtaatttcacagaatttatt
ctaatgatttattggagttaaccatctgacattaattattgttttggcttccagtctatg
aatgtttatttttcagtttaaagccttctcactctttgatatcatatggaaatgagaatt
tttaatggaaaattgaaaccatgtgcatctaagtacttaatgaagtacagggagaaacag
acaatatagtttaggagaattcagatattttgctttggatagttttgatttgtttgtatg
actcaatagtataaaatacttaagagtccagtgaggcaagtcaaagtgagtggtatgcca
aatgtggacatgcccacaggtacatgaacatataattttctgaagttatcagtgatagta
acaaatcttgtacattttggttacatgccaaaaatgacaatcaatacatgaatgcatagt
ttttacctcgatgtacttttaaagcatttgaaacaggtactGGTCTTTCCCCACACACAG
T
Primer
(+)CACCGTGGCCAAAGTCACAAACCT
(+)ACTGTGTGTGGGGAAAGACC