Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs238 ]


Position: chr1:38,560,194-38,561,606 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: MIR3659 - LOC339442

Expression Pattern
neural tube (13 out of 20 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5


Embryo 6

Fasta sequence
tcCCATGCCATTAGGAGTGCTTGGagatcccaggtgctcctgaatgatattaatgcatct
atatgaatattaatagcatggccattaatattaatgacaataataaacaagtgtgaggat
tatttttaaagagggctgctgctccagctgttgcctcccttcattaataagctgctgaga
ttctcagccatcctttccccagacctctggcaagactcagtggcatcctcaggacctctg
tctgggtaggggtgagccgaaagagcattttcccaacattttggatggaaggagaatcaa
tgcaggaaaccctgagtttccgtccaaggaggtccgggccatgtgagtgggcatggggca
aaggagggatgaatcggcttgtgtatgggagccagctgtgaggaccctacttccttctct
cgcaggcctgcggccccagccgtctgcatccccagaggaggctgggccaggagggggttt
gcaagggaccaatctcttgcaaaggtggtgagaggaattaccctgctaaagtgatcatga
attatagaaaggaagaggggggaggaaggcccagaatatcatatgtgtaaataaaacgga
gtggcggccagacatgaaagccagccaccaagctcttgcacccacagagcctcttctcct
gtggacccacctcctgccaagttccaccgcaagtcacttccagcctccttcttcaaagga
tttgttaataagtcaatgacggaacatctaaaggggaaaaatatttctctttatggttga
agataattgtcccaggaaaaaaagaaaacaacaaacctttaattacaactcacatggaga
aagcttgatttgtgggcagagcccaaatgctgaggagctggatgtaaaatatttgtaata
tttagggaacctagagttttacataaaagtaaacagcattgcctgaaggcacaatttcca
gcaacacaataaaatgtgcagtgaatttatggcggccatccattagctcttaccaaggca
acgtcgcccctatctgtcgtccatcattataatagagggttaatgcaccgaatttacata
aaaaagtcatattgtctgcatgaattatttacacttgaagctgtttttacagcttggttt
caagctggattctgggagagattctgccagtaaattactctgtggagacctggttctata
actgtgcgcagagccggcaatgaaaagaaaggaaaatgggcaggccctggcgggtcgttg
gtgctgacgcctctcgggtgggggctggaagcagtggtggaggcttctggaggtggttgg
atgttgctgcagatgggactctgcctctgggcctgtggcttcctggttgccactcagctg
cccgtgtggccaaAGTGAGTTCAGGCCCAGAGA
Primer
(+)CACCATGCCATTAGGAGTGCTTGG
(+)TCTCTGGGCCTGAACTCACT