Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs234 ]


Position: chr11:31,685,357-31,686,884 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ELP4(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
eye (9 out of 21 embryos) 
midbrain (mesencephalon) (10 out of 21 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 11


Embryo 15


Fasta sequence
tAgtTGGAATATTTTGGCATTTTGGttaggaaatttaaacatgagcacatttttacttaa
taactgcttttatttaagctaatgtaagttattgtattttaaaataattatataaacacc
agtgtccttaccatttgaaaattatttttaaattatgtaaaacaaaacttcttttcaaag
gtgtttacgatgtagaatagaagattgcatgaaatcacacaaaaagaactcaatgtagtg
ttttcagcctaataaaaatgttgtaaaaatacttgtaagcttggaaatcacactagctat
tcttgtttcaaattctgtttaatatattgttctgtatgattttataataaacagattact
ccttgaacaggaattaagaataaagctgccaggaaggggttttgttgtcagagtagttcc
cgcctcatgttttgtaagagatttcatggtcccattgtaaagagtagatgatttaaaacg
tgttcccaagataaactttcccattgtcattaatgaggatggataatactgagtgacaag
tgcattaggaatgacacagaaagagctgttagatttgtcagagcgtatcacttcaggcat
tgacacttgaggacattctttttgtggatatttggttggggggggagtctgatttaaaga
taccaaagtttgtgtttgctaatagaataatgtattttacaatttataaatatatatttt
tcagtgtttagaaaatatttggaaagttatttagattaggttcttccacattttaaattc
atgcttttattataacctgatttcttcctgagaaagtcatcaaactgtaagacatttgaa
tattaaaatagtcccataaaactaaattcttcttctaaaaagtcttatttctggaaatat
gcagctgaaggaaagatactaaaaattaaacaaatttttaaaaaacattttgctatctta
ctcctgtatctaaaagggtactccttactatgcatcaccttgagaataaaggttttgaaa
taagaaaatacatgtaattttattgtctctttgaaaatacattacagaaacatgttttaa
atattaatcaatgcgcaattaataatgtgtgacttttctggtatttaaagtatttccaag
ctgtagtatgcatctcaatttcgattttgaacatgcaattggtcacttttttgctttgat
tcatcttttatgctgccaaccaaattttgcctctgtatacctttttgacactaataatga
ctgagtctctgttcatttgagttcaagatttcccaagcggcagtttggagctgggataaa
ctatctatcatgattgcataccactaatctgtctcaaccaaaccaccctatgactgaaat
tatacttgacagtttacctcttcttgatgagcctgaggtgaacatagctacagaccatcc
ctgggaggacatggcaactactccatatgctagggaggatccttttatttgtgacacaag
acttaaacTATGCCTGTAGCAAAAGGGA
Primer
(+)CACCTGGAATATTTTGGCATTTTGG
(+)TCCCTTTTGCTACAGGCATA