Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs230 ]


Position: chr5:158,340,962-158,342,611 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: EBF1(intragenic)

Expression Pattern
neural tube (7 out of 8 embryos) 

Embryo 1

Embryo 2

Embryo 3

Embryo 4

Embryo 5

Fasta sequence
gAatGAGCTGGCAGATGCTTTCTTcagatcattaagaccagatatcaataatttctgagg
agtagaggcaaaagtcatcagaaacaacctgatgtggtggggccacaccctgtctttctc
cacttggcctggtgtagggagagctgggacacaccagctgtttaaaaagccaagtggctc
ctaccacaccagcttgttaaccttcatcttacatgcattttttttcctcccagattcatg
atctcagattaggtaggtggtgggggcagtgctaaatataccttcctgttacccgagacc
tggatcagggaaggtgcttattaatatcatggagatatgatttttaatgatctctgaaaa
cagcctatatgggtgtgaataatggcactgtctcattgcatgcgtggtttgtgcttttgt
ctcagacaggttcatttttcactggaggggaaaggttcatgccgcacgaggggggtaacc
agttgatgttacaaggctgactattaggccccttgctgttccacatgtcacagggaagga
ctccagccggcaaccttaatgcctacttcagcatcttgaagaaattaatgaacacagctt
ctatggcaaaacatttcaatcaacccttaccagctgtgcctacatttaagaaaaagaaaa
ggagggggggaaatgcccaggtttatcaaaaaagtttcttcgaaagatcaaccacggttt
tggctgtgtgtggggcggtaggaggtggggaaaggaaaggcagaaggaataaaggtagaa
ggatgccagtaccgagtgccaaaagatgtgctctggccccggtgtttgttgaacaaatta
agcacgttctggtttttcacctgctgaagtagcagcagtgcatatggcctagaagttaaa
aataaggaaatatgcatacattaccatacttaatggacgaccctctccatttaatatgca
aatttcctgaaatattactgaatgccgtctgttctaaatgaataaatttgaattgcaatt
agaataatcctttataattaatgaaaactgtcaattttagttcataagtaatttgattaa
caggatgatgggacacttatcaagttcactggactgctaggctatgagaaaactgacagt
gaaaatggggcgggccaggcactcaggctctaccggagtattatcctaaattattgataa
cacaagctaatgaacttcagaaagtgaactctgggggcctcatttaaagggacagcctcg
gagggcgatgggcagccaccgggatgatgatctttccaaaagccttctttgctggtactt
ttggattgtaggaaaataaatgtttagaaatgccagggcaaaggaaaacattggctcaaa
acacaaatttaccatttccagctgttgctggaacaaaaggaaacaatagtcagaggataa
atgtaagaagaaacaatgcaaaaacatgtggaaagaagttgctggtaatgcatcacagaa
gtaggacatggccacagcagcggggccatctccgcttcccttctttgtctctcccttcag
acagatcatgaacaagaacttttaactagcattaattggacatttatgtaaagcaatcgg
ggtggggggaATTCCGTGGAGACACACAAG
Primer
(+)CACCGAGCTGGCAGATGCTTTCTT
(+)CTTGTGTGTCTCCACGGAAT