Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs23 ]


Position: chr16:55,424,416-55,425,738 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: IRX6 - MMP2

Timepoints:
e11.5

Publications:

Expression Pattern
hindbrain (rhombencephalon) (8 out of 11 embryos) 
neural tube (8 out of 11 embryos) 

Embryo 2

Embryo 3


Embryo 4

Embryo 5


Embryo 6

Embryo 7

Fasta sequence
TTGCAAGCCTAATTTACAAGGCTACgacccccgcctgtgttgggttctgcatgcagcagc
tacttcaaccttccagacttgatgccatcttcactttaatagatcagctttccctttctg
gtcttgacaagtccttactttacctaatgggaggccacaaggagcaattctttgaaagga
aagggggagacatccttagaaaggcatctaaaaagctgccatttcggtgccgagagaagg
ccataggcactctctcaatgacacatgcacaaaagctcttgttgtggacacaaataagaa
aagttgaacccctcgcccggtgtaattcacttcatttattgacccgagttctctccctgc
aacccttgattcctttgaatttgtcagcagttcagagacccctggcattcaacatgattt
gtaatgtaaattatataattgtactttcacatattttaacatcaaatgaaatgattgact
acagaatcggagctgtctacaggtgggggccaattaccatctgaataatcacagtgccac
acaagaatagcatagccgctgagcgtgacatatttttatctctatgcatttcaatgaagt
caggctagtacataaaaggttatcacctaggaaacatattttcctaagcacaagttaaac
atgcaagtgagatcagcaaagatattcaatttagccagtcaaccctaacctattaatatt
ttaacaaaatccagggaggataatttttttctttgatcccatttcatgtgagcagccggg
aaagggaagaaaaattaaaaacaaaatagtcaagcatacagaatgaggttatgtattaag
tgggctatttaatgtttctggcatttcatagcccaggggaaagtgtggatggatttaaca
atcaagagctgtgttcccttggccacaaagttcgagaaacataaaataatctatacttcc
aagctgacaaatcgtacctgacacccagcttcatctcaccgggactcctgagatcagcat
taatcatatgttacagggagtaaaaagaaaagtaaatcacaccacgctgaaaagtgagat
ggaaggtcttcgggcaaggattttaatcaataatatgtgggatgataaccagaagctatt
gttttaatcttccaatatgaaaagaaataaatgcaaaacacgaagctaccaggggccaag
cggcttccatgatgccttgtaagaaccaaaaacagtttggcagctcaactttctagtttg
attcatgacaacaaactaacaaacgatttctttttaaaGAGACAGAGTCAAGTGCATTCT
TCA
Primer
(+)ttgcaagcctaatttacaaggctac
(+)tgaagaatgcacttgactctgtctc