Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs229 ]


Position: chr10:102,546,590-102,548,095 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: PAX2(intragenic)

Expression Pattern
heart (3 out of 5 embryos) 

Embryo 1


Embryo 2


Fasta sequence
agCCCTTAGAAGGGGAGTCTGGtctcccgatcttgggatcctgcccccaatcttctgcct
gcctgtctttcgggatctctcagtgtttgtctgtctcttatttgctctagttgaggtata
cactgatcctgcccacattagaggaggtggaggtttgcatctggtctggactttaagagg
tatgagggccagagggaacatggcgtgggggtcaagggaaatagcttgggggtggcggtt
agagaacattcagagagtgggttcctaagggccagagcatggaaaaggaggagttggctc
aggcttccactgggagacctggaggctaacagagtctcagggcctggattacttccgcca
tgggccactgatggggtttgggagctgaggccccggtggcctggagggtcaggcactcag
tggatggggggtcactttttctagcccttggaaaaacaaagagcagatcgggtagtaaaa
caaaagcaaaggagacctggaagcacctgacagccctaattcatcacagcccaagttttt
tcctgtgttcccattatatttgtttgtaaaagtggaaatcaattttgaaggtaattttct
ggaaagaatggaagggaggtgggagggccggataaggcagagatggtaaaaggaaaaatt
taggccaggcacagcccaggggcagctcttggcaaggtgaaagaaaattgcatattcaat
ctccatccatgaatcttcctcactgctgcccgcctcctgcttgaaaacaatgaaggcttt
ttcccaacgctgggcagggcctcggtatcagcctcactttaacttcagggtcattaattc
cctgattattgaaggagaagagagggttgcagcatcgtcaattccaaaggcaccccctca
tgtgatcgggcactggctggggttgggtggggggcacccagggcaaagtgaggtgttgtt
tgagaaaggtgtgaggagcgaggaaatgggggagccactggactatgggggaaggaagcc
aggagggtggaagaaggcagtcattactgcatacctctgttgtgttgttattgcaaatta
aaagtagcatgttccactccacagctatctttggggagggaggggcaccgagggaggtgg
gggatcttatcattgcttcttcagcagaccagccgtggtgtcaccgtgtgaggtgacatt
tgaatttacaattccgctgagaaaagccattaattcacaaattaacatttctccctctcc
ctctctctttaacactctctccctctctcacatggatgtgcaagcaattgaaaagacaaa
ggaaatagccttaaggaagagactttactgctagtctgtgctgagattgctccccctgct
tccagatagataaaccaattacctgagcagctctgctcctggccgcccgcgatcgcctcc
ttttgtaggctgcctccatggctggattacactcggtgtatctcatTAATGTAAACCAGG
CGTGCC
Primer
(+)CACCCTTAGAAGGGGAGTCTGG
(+)GGCACGCCTGGTTTACATTA