Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs222 ]


Position: chr7:114,295,109-114,296,373 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: MIR3666 - MDFIC

Expression Pattern
heart (3 out of 6 embryos) 

Embryo 1




Embryo 2




Embryo 3




Fasta sequence
aAaaAAGACATGTATCTTTTTGAATCTGACAtactactttttaaactctaaaatgtctga
gtttttaattaaaaaataaacttttgaggatatttttgatcatgtatttatgactatctt
ttcaataagattttttccctcattgcttctatagtataatgtagataatcacaagacaga
ataattgtctcataaatccatcaggaatctgcagcttgttcttttccaattaattattca
atcagtaaattttttaaaactccagcagcatggttacatctacactaataaagaattttc
agcctataatccaaaacagaacctgaatgaataatgtaattgaagtattacattacataa
accacacatgaaagaattgctaattgcgtttgatggtgggcaattaatacagaatcttag
atgagcgatttaaaatgaaaccacagtttaaagttccctttggaactagcgatatctgaa
gtgaggaactgcactattggcctcagatcggtttgaaagaagagtggtcaatactcacaa
ccctcaaaaaaaccctaaaatttatacactgtacaaaagaagcttcaaaattgatatgat
agtagagatttatggtctcatgtgcagtggctcagttgagacggcccacacatttgataa
atattaatagcatgaatttattaccaaggagaaatgagctctgttggttcatcactgcac
ccttaacagctatcagtacatgaacacaaggtgcaaccgcactgtctattatatgacccc
atttactctctgaatggtacttcattaaatggtaccttttggccatgctatggatggatg
aaaatcaaagttatcaaggctgcgagtcctgaataatgagtttcacccaaccttgactat
attcagatgagtcgaggtggctaagtgctcatcctagcttttacatgcttccctttagtt
aataataaattctattttatcagtttgtgattgtacgcctacaaacatggtatgcttatt
attacaggatagcagaataagttaccgtaacattgtaaacatgagtggtttgcattgaaa
aagatgtatttctcctgttttgataacttttaatgtgttggtaaaatgtacagagtcctg
tcacatattcatcaggatagatatttcattgatttgcaatttggtattttctgggttctg
aatgtgccattttgttctggtttgcaattctaaaagtgaataTGTAACCATCCAGCTGAG
TTTTT
Primer
(+)CACCAAGACATGTATCTTTTTGAATCTGACA
(+)AAAAACTCAGCTGGATGGTTACA