Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs22 ]


Position: chr16:72,254,566-72,255,825 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: PMFBP1 - ZFHX3

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (7 out of 7 embryos) 

Embryo 1

 
Sections available
Sections available
Embryo 2

Embryo 3

Embryo 5

 
Sections available
Sections available
Fasta sequence
TGAGAGAGGGCTCAGAGACAGtactcggccttgcatttttctccaggccttgcaggatgc
aaggtggacagtgctgcagtcctgtggatctggtgccctaggctctgcagacacattgag
gggacccagggctctgaacaaatggccagatggtaagaacacatccctcgagttgtttct
tccagttgcatttttccctaatcactgtctgctttgggaaaggtcgatcaacctagcaaa
agtaccccctggacatcttcactaggtccactgactgctccccagaactctcagtttcct
gaggattgtgccctttcccttcctttcctgctgcagcttctcagcctaagcgaacctaga
gagagcaagggtggggaaggagagcaggggtatgtgattgcgctgagaacaccaaaagcc
cataaagtctgaaaggttaagcaaagactgaggcatgaagagtgaaaattctccattcaa
caataatcctcgccccctgccacccctgacatctcttcttaaaatggaaagaaagggtgc
atgatgacattaggcactttaaaatatgcaaaattaggagctggtgcagacctcattaac
acccgcctccaacatcattaagatgtttccaagaaaattaattgagagactcattaaaaa
taaattaagaaaaatgtgttgcagagcgcctgcactcagctcataaatcacagctcagtg
ctctggcccgctgctccggcaattaactccaacctatttgttttatcctgactgtgaaaa
ttagaaagcagacgtggagattagattaggaatgtctgtcaagcggaacttggagtgaat
attttaggatacaaaatggaaaccaggaaaacaaagacagcagagatttcattctgagga
gcttgtctttgaaaagtgacaggcagatgaagggtgctggagggagagtatggggaagga
gtacctactctcgggaaggatgaagggggagagaaaagaacagatgtttaaactcttctg
accaggaatcgtgcaatacatttgcattataaatataaacagttacacatcttagtaaag
ctggcattgagacataaaattgatgttcctgatgatacttcatatgtcatactttaatgt
ttagacatagagtcatttggttgaatcactcgaaagagttactggtctcttgcaatattt
tatgtatcagtgatgaccacatgttcctctatatgaggtgAAATATGCCAGCCTCTTCCC
Primer
(+)TGAGAGAGGGCTCAGAGACAG
(+)GGGAAGAGGCTGGCATATTT