Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs200 ]


Position: chr1:51,165,195-51,166,786 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: FAF1(intragenic)

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (10 out of 11 embryos) 
limb (4 out of 11 embryos) 

Embryo 1


 
Sections available
Sections available
Embryo 2


Embryo 3


Embryo 4

Embryo 5


Embryo 6

Embryo 7

Embryo 8


Fasta sequence
aAaaTGGTTGGCTCAAATAAATGGttctcttttaagtgcattttatccctttaggttcac
acaataacagcaatatatttttaaagtatatattttactcaaaaaatacataagtaagtc
agaaaccaaaagctaacagatgtgtgacttctaattagttataataatctctgcttcaat
gccattagaatgagccttccttttcttttgaaaactaaaaaagctttcctttgaatttta
aactgtcagggtgcttcaaagtcaatgtacaaaatctgctttgattaaaattttagacat
ctacagtgataactttatgaaaggaaaatattaaattataattatcctaaacagacacag
tcttgtgaaactaaccctacattcatgttaaaacacaaagagttgaatataatgaatttg
attcatcctcggacacaaagcttcaccacagtaaactcagtcaactgttgctcttgcgcc
tatattcatggtgcttaaatagcgcactttaaaacaaaaaaaactccaattggcttttca
tacatccaccctccccaaaaataacgcacttgaaaaactcaaatgatatgaaaggcttca
aggcctcttttctccctttcatacccccctttttttttttatttctgtttgcagtaatct
gcctttctctttctcattgctacagagcaagcgaggaggctcagagctttgaaaaggggg
ctgtgtgtaatgggtccactagaattaatttacttgcaccaaatccattgagcacagagg
ttcttttcccccctctctctctctcttctcaaatcatttggagtcgaacgcagcccccgg
cctttgtaattctagtaaagcacttaaagtgcacagtaggtgttcatgaggaccatctgg
tcaaaagcaaaacaagctgctgattttgcctttgaatagaatgaagcaagtgtgaattag
tctcttcaattagcactattacaacctgtcaagtgcatattgtaaaacaggattattaca
gtattggtcaccagtgcaattatttactctctgccttttcttgcatataaaaaaatctta
tgtttattagtttctgataactgaacggaatttctcttaacccaggcatttcaaaactac
caacacataaatcacagatgatgaaatgtggtcagctatcatgtttgatacacatatctt
aagtaacaaaaggctaaagactgttcttaattcttaaaatgtcattgcttctatcgtctt
gaaatgcaggtagacaaatacttatatgggccaaaaaagatatccaatccagattattct
aaaatagttccagagaggggaaaagacttgtcagttccaaagagctgcattataaatatt
aaatttattacttcaggggataatttgttaagaatcacaggaaacctcaatatttataaa
atgatccctactgatttatattcatttgaagtggtatgatttcaacagatctcagttttc
aaatgcaacttgaaactaataatatatatgcatatttaaaagatgcataatcgtcttttc
tgaaagctgaatAAAGGCTTGAATTCACTGCC
Primer
(+)CACCTGGTTGGCTCAAATAAATGG
(+)GGCAGTGAATTCAAGCCTTT