Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs20 ]


Position: chr16:72,738,568-72,740,149 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: PMFBP1 - ZFHX3

Timepoints:
e11.5

Publications:

Expression Pattern
hindbrain (rhombencephalon) (4 out of 11 embryos) 
midbrain (mesencephalon) (8 out of 11 embryos) 

Embryo 1

Embryo 2

Embryo 3

Embryo 7

Fasta sequence
AGGCAGATTTTGGGAGGAATaaaaggaagcgctagagataaaaaactaaattcatcgaaa
ttaaaagatccattttcaaataaaaaaattctgaaattttccaagaggcaagaaatactt
ccttctctgttgaacagtgagattctttatgtgcaccttcaagccacgtagcatattttg
ccagtgacttctggatcttaacatgtgactcctataacctctgagagctaacttactgag
ttctagcaaatctcaaggcagcacgccatgtgttagttacactgcatagcctcttcaaaa
taaaccacaaaatactcatgttgatcctgtgagattaagacaaattaaaaatctaataca
tagttttgctgtcaggtcctaaagatcaaaggtcaacatagtatattgcagtaaggctat
aggttacccatgccccaatattttatcataataacccaaatggggatgaaacacccagca
gtagcccataaatctattagcagtgaactgtcagtgtcccatatactagggtaatttgtt
aattcagacctgggtctctcttttcactagaccttgtaaactcctgtttgaaatatcaat
aaaccatctgctttgacttgttaatcaaatgactttattcagtccaaagcagttttttcc
taataaaaacagagtatttatctccatggctataaaagaggattgttttcaactgttcac
ttatagttaagaagcacatttcatttggattgatttccaatgctttggtcatatcttgtc
actttctatttcttacacacagcatctcagtttagccatttaagaagggaaaaacagtca
aaatctggatgaggtatgagactggcacaaaaaaatctgaggtagaagtttgagatagga
aagaactcgaccaaaataattatagatcaacattttaatatgatttccttgtggaagttt
tcctatcgctccagatagagtgttcacgttagtcacggtttctgcctcaactgaagttcc
agatgtttgccttttagtcagtattgctcggttcagagtcacagagcagataatatttat
ctataatagaaactttttgtcctctgttaagctttattgtgttagtgtaaaataaagtca
gcctcagtgagatgggatcatagcatgtgaagctctgcaagtctatcccagaaaattgac
ccccttttctgtaacccaccgaactgagacaaaatgagtatttctgaggtatccgtgggg
atactctcaatgctctgtgaatgagcatcttgaggaatcgtcacgcttcttgcaccctct
gtccttggagcttactgccagctggcaaatggagcacagcctatgacctctgaccttgaa
tcagctcctcttggactgttagaaaaatgatgtctgaggagagttctgagcatttgagtt
attactagattccgccctcttaaaacacaaagaagaaatttgtaggtttccttaataagc
agagtcctcaaatgcaacacagatcatagtgcattctgggaattgtttctcaggggcata
gcTTCCTTTCCCACTGCAAATC
Primer
(+)AGGCAGATTTTGGGAGGAAT
(+)GATTTGCAGTGGGAAAGGAA