Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs191 ]


Position: chr5:91,036,888-91,038,899 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ARRDC3-AS1 - NR2F1-AS1

Expression Pattern
hindbrain (rhombencephalon) (6 out of 9 embryos) 

Embryo 1


Embryo 2

Embryo 3

Embryo 4


Embryo 5


Embryo 9


Fasta sequence
TTGTGTGTTGCTTTTCTGCTGttaagcaaagggatagagtggggaaataatttcacactg
catataatgcatctgatatgaaggaaacttgaaaattatttagttacagatttctctgac
caggcttgcaaagtggcatatattatgttaatgggcaagcatttgaaaatgaatttgaat
attaaatgcactaagtttgggttctgacacgaaggaaggcatagctggtatacaatttac
aaacaggttcttgttaactctttcattactgttgctcacaatcatgctttgtgcttcaaa
attgaagagtcatatttttcactgaaaatttataacaatgaaaacgattatggtatgcaa
gtgaagttctgttataatattagattgtaaaccatattctctgttcagttgtgttctatg
gaaagtagttgcttattcattgaaagtttataagtagaaaagaaatgagcaacatcaatc
actgtattaatggtatactatattttgcagctttcatttgtaaagtaacacatttgagtt
ggcatatattggaagtatactaccaagccaccattatacattcaacccaaatatcttgtt
ctcaggtccaagcagagaccacaaatgtactattagtggactcatagtgtttaaatttac
agaaaatgaatagttaatagtaagtcttcccaccaaagcatatttttattgaaagagcaa
agcattatagtataccggatgttttaggtcatttattttgtttttgctctgggtcatttt
acaaaagcacttctgctctctagcgttaaaatgagagccactctactccccagatattac
ccagcagcacttgggggctcttaatgattaataccatcaccgtccagccacaaacctttc
tgccgcagataatgccaggcagcaagcgcgcttgacacttttaatgtataattaagtagg
aaaagtcagcactcagtatgcaaatttttcaaaatgataaatgatgccatacagcagtag
ggattgatttggtgtaaatgaaactaattaaggaaatgtcaaacataattaataaaacag
gtttaagctgcaaaacattgtcaattgaatgaatgaggaggcattggctcccattgtttc
tgctttatttagggcttgtgtttagcttgtactctgttcctaaatgcactttcgctacct
cacaccctccactaccaattcccagagagggggaaaataaatttgcttgtctctccactg
actgcagaaattaattgcagaaatcttgtcccatccaagtgttacattcactcacaggac
attaacataactaatttgaaagagcccaaatgactgcataatagagcactgtcagtatgc
ctgacagtctttggtcataccaaattagcttggttttctaattgaaattttttttcctta
gactctttttataattttttcctcagctattcattttttataagaacaaaggttttatga
tttacaaaagagtgcttgacctataattactaggaggaaattaggggaggtagaaaagtc
agatttagtcctggtaatgatgctagagaccttgctccctctagggagcctgaagaataa
tggaatcttctatttttacgggcgacctgtgcactggtgctgactctaactgtgaatcca
ctttactttgcagatcacttgcttaacactaaaagtgccagcagaatggcaggccattac
tccaaatgtcattcaaatcagtgccatttccacatgcccttccttctcaaagagtgaatt
gaagagcactgccagtcctcttatcacgcctttgtaaatcttccatgtagagttctatgc
aacttaattgatgaaccatttgggtaaataagggtgagaggagggtaaggagtttgttga
gagtaagaaatttaaagaatgataaattgattcatttggaaaagaatccaataggccctg
attttacaatcaTGTCACCTGCATGCTATGGA
Primer
(+)TTGTGTGTTGCTTTTCTGCTG
(+)TCCATAGCATGCAGGTGACA