Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs169 ]


Position: chr1:63,464,282-63,465,717 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ATG4C - LINC00466

Expression Pattern
neural tube (4 out of 4 embryos) 

Embryo 1

Embryo 2

Embryo 3

Fasta sequence
TTCCTCCCAAAGGGAATTTTaaataattggtaacattatcttaggaaacacaaatggtta
aagagaaatagaagagacacatggctttgatgtctactcagctgcaaatggtaaaaactg
cttttatccattttattaaaattgaactttgttatatcactgaaaggttacttcaccttt
aaatcactgctcacgtcagccttaaaattggtaaaatgtagaattgaaaccctcagtgtt
tagctggaatatccacaagattatgagcctttttttttccaaagagaaagttacacaata
gtagagtggtggttctgttattctctgctgaatctattttgaaagtggctgcttgttttt
ttataaattccatcagcaatctccctgccaagggctacggaagcaagcaggagctatagc
atcagatctatggaaggtcagcacaggagatgagcaaagcagggcaagcttaacaagaac
ctttcaaaaattcaattacagccaaagaaattaataaatcctttctgttggtatggaaca
agaatttgtcaacctgtccatttttcagcatctccccctgaccccggtcaattacattgc
ttgtaaatagtttttatacatgttcaaataattgctcatcctaatgtgcagtgatctgta
ttcgtcatgctctgaagctccagcccatctctacaccgccaccaggacccattactcggc
tgtaagtgaaattgaaattgaagttataattgatatcggggcccatcaccataatgggtt
catcatagcgccatctaaaatattaattttctaattatggataaatgatcagacaagctg
agccagggctcgcaatggagcccctgggaattggtgcttgctggatgggaggacagggcc
ttgtaaagcctacaaatcttttattattctctgccgcagcacagcgagattcaattctct
cagataataggtaaataatagttaaggatcaggctgttaggctcaattttctctctttgt
ctctcttttttttctccctggtttcataatttaaagtaatgccattactgtaaccattcc
aaattcatttgtcaaagagcctggaacatcatttaattttaatcatgataacaagacaat
gtgttaataattccaggttggaggaaggcatttgaaaacttgtttacctgtttactctct
cataccatatgcaagaagaatttatgagccggccccatttttctttgcagccggagacat
atttggtagcttcttggggcctggggaaggaattgggagtttgtaggcaagtgtgtgtgg
cacaggtatgtacacacttggctgacacgcaacagccacaaacttcctgcctgggcacac
atggggtcctgaaaagacagtgtcacaggattcattTTCGTGTTGACATCCAGCTC
Primer
(+)TTCCTCCCAAAGGGAATTTT
(+)GAGCTGGATGTCAACACGAA