Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs161 ]


Position: chr16:52,446,050-52,447,237 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LOC102467079 - TOX3

Expression Pattern
hindbrain (rhombencephalon) (3 out of 4 embryos) 

Embryo 1


Embryo 2


Fasta sequence
CAACTATACCCGGTTGTTCCATtaacaattacaatcaaatgtcattccacctccccaagc
aaaggatagagagggtaagaccataagtgccatacctaaggagttccctctgccttgaag
gaaacatcaagagtagagaagaagcattcccatctctcaacacatactcccagccacttg
ctctagtcataccttagaggcatgcgactgatgggtgccaatggtctcctcttatgttcc
cagtgataaaaaaagaagccacaaagagattgtgaggaaatgatctaagagactgggtaa
tatcacctaggagaagtagacatggtgttactttataaaaaaaaaaaaatctcttttttc
attctttcagtcctgaccttttcttatccaaagtttctttctaaatcttttttttttttc
tcatgtttttgggactatgctgaagtggaattttatgcttcaagaagagagttgatgatt
catggaaagtgtaattgacaaagagttggcatgtttttcactcttcttttttctgcatca
actgaataagattagtgtcttacatggattattttttcaataatagggaaggctatgttg
gcaacaaaaattgcaaaacagcaacatcataggcttgcctaaccatccagtggaagagaa
ttttcaacttgaaaaacactcttggtctagcaatccaaggacctgagtaacaattacgac
tgaaatcattaagcatccatgttttctcctatggagaaattggatcctctagggttctta
gagggaaaagcagaaacattaggggaagaccttacataataacctttctgtaaagcttgg
atggcacaaatgattttgtaagacattcaagtcacatgtcattaatcagaaatgacagtc
tttattcacatatatttgactgagctgcataattttagactccaataggtctagataaat
gaccctaagtattgtactatttcaaattgacaatgattgatgatagaggaaaaaaacgaa
tgctgaaaagggaccctgaagtaaacattgaaaatcagttgtactactttggggaaaaga
aatttgggaattttcttcttcaagacctttcctctttcttaacatctctatctacttaac
tctcagtttaatcagttagatattgtCAGGATTTCAAACCACAATGAA
Primer
(+)CAACTATACCCGGTTGTTCCAT
(+)TTCATTGTGGTTTGAAATCCTG