Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs157 ]


Position: chr16:53,986,630-53,988,193 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: FTO(intragenic)

Expression Pattern
eye (4 out of 10 embryos) 

Embryo 1


Embryo 2


Embryo 3


Fasta sequence
GGAAGAATACAGCCCACAAGACtgagatgtgggtgggaattggatctgccaggtcccaga
gctagacctaatgcacatgtttgaagttcttctgtgactctcgattaaccttgatttaaa
gttccagaaaaatgctcaagcaggtgagaattctcatactgtctttctcatttgatattt
ttctgagccaaagtgcctactttttttgagcggtatttatgactagttacattgcacaag
gaaacttgacttgggtgaggtgttaaggtatggagaaatggataattgggaaacttagaa
aacccgtccaatgaacgtttccaagtcaccctccccacgggcctagagtcatcatgaaca
attacttgagaattgtgaagggctcaaagaggaaaactgcagaacaaaatgggttgaaag
aatgtatacttttgtcatttcgacttgaagccaggggctaaaactcatgtcttacaccat
tgtagtctacaaccatttaatttgctaacaagacttaactgatcaggatctgcaacctcc
ttctccagtataatcaaaacaagaagcatttggctctggaaagtaaacgttgtctatctt
ttattgtctggccccaccattttctttctggcaggctgagatgaaacagaaagctgatat
ttggagccactggaattgtaggccttgtaatttagaaatatccattttatcccgtgtaat
ttcttccctaagattcctcagtctaaatctgatacaggtaggagccaagacaaacagtaa
ccatttatagtcacccagaccagtttgaatttcactctaatgtaaagcaaaaagagtttt
tggcttcatttcaggtgtgtaacaggggtagaaaatgcatttaaaatttagcagcaaatg
ttaccatatgtttccataacaactgcaaacttttatgttagaaaagcaataatataaaca
cgtaggaatcttggaacagcaaactattaatttaccaaatataaaaaaatccagcatgaa
ggggcttttatagccacagaagccatgaggggcccagcatcctgtgaatttctccattat
gtggcagaaaatgctgctggttcatttaaatgagcaaatcttttaaaattataggtacag
tgtccattctccacagtgcatttttgtgaaacaatgtgtggtgatgccagctatggctga
attcttcttaccatattgaactagtaaaatacgcttcggaagctactcccaatgtatatc
tgtaaaacaacagcattttctaccttcacttatagcttcaaacttaatgacgaaggctag
ggtcctgcagaaagtgtagtgcccagtagttggccctaatgcttggcaaggagtagatgt
tcatagattgttgatagatatgaacaaggttctcagttttctcacctacccattttgaaa
tataaaaagacaaggggaaaaggggaaaggtggatctatttaagcacatctcgagaatga
ggagttagtaagagttgttgaaatcaaattctctgttctctgATTTCCCTGTGGAACAAA
GAAA
Primer
(+)GGAAGAATACAGCCCACAAGAC
(+)TTTCTTTGTTCCACAGGGAAAT