Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs12 ]


Position: chr16:78,510,608-78,511,944 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: WWOX - MAF

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (9 out of 11 embryos) 
hindbrain (rhombencephalon) (9 out of 11 embryos) 

Embryo 1

Embryo 3

Embryo 7

Embryo 8

Embryo 9

 
Sections available
Sections available
Embryo 10

Fasta sequence
AAGCTAGCTAATTGCTTCTTCAGTTGaagacctaaatgagttttaaagtgaaatgcatat
ctctaagggctaagtagccaacacaataggcaattgagataggaaagactaatttagaaa
aggttgttttgttcgtttttctttttccttccctcccttcctgatttcccatcttcttcc
tccctcttctctcccctctcccccttctcctttccgtccttcctccttcagttccctctt
tcctctttttcacccttttatttaacattataaatacgatgggattgtgtctgcgctttt
gttggtaattaaataaattatttatacatttaacacaatcttgaattaccaggtgatcat
cttaggcactcaaaagcataagagcccttgaaagcaatatctaagcatagatattccata
gcacgtcttacaatctaaatattgcttttagtgtaatcgaagcagcaagagtagtcacag
cagttgatggactatttttcaaattgatttcaaaaatgtatttaaggggatgatcttcta
gtctagattacctattgatttttaatatgaaaagctcattatgtaagcagtaaccgcata
taaaaacctagcaaacctttgcataaatcctttaattgaatttccagagcctgtggttct
actttttttttaattaaatctatttctttttttaagtgttactgtgtaatttgcatgctg
tgaagaggccctgtcccagataaagtgccattgatccttattaaacctcacctctgggct
tgcttaaaactaactggaaaaattaaagtgttcatgccgcaatgcacttatagcttgtgt
gataggattatggaaaaaataataaaactaatttccaggggagaatttctaatgtgagat
tttattttttttcaatttgataattaatagtgaaatcatatcatatatataaatcatatt
ttagcctataaactgaaatggcaattaggaaagataatatatacttgatgtaaaaccatg
ttacgtgcggataatcttttagcactttaattttttaattgtagaaggagagaattatga
attcaagtcaaacacattaaatggtgggtttcatccaaaaaatctgattcttttactatg
tactgtattagtggatttataatattagtgggaggaagtataaaagatatggaaaaagat
attctggttatgttcgtgctaaaatgtgtgtattagaattaccaggggaaagaaaaatat
aaaagctgcaataggtttttctattttttaatacctaacatttgttattttAAAAGCAAT
AAAATCCCCTAAAGAAA
Primer
(+)aagctagctaattgcttcttcagttg
(+)tttctttaggggattttattgctttt