Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs112 ]


Position: chr9:973,435-975,288 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: DMRT1 - DMRT3

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (7 out of 7 embryos) 

Embryo 1

Embryo 3

 
Sections available
Sections available
Embryo 5

Embryo 7

Fasta sequence
GAGAAGCTGACCAGGTGAGAGctgagtagttcacgcacaggaagaggggacaagtttttc
tgttttcacaggggttcctcacgctcaggcttccagcgtctgcctgcactgacatcatcg
tggtcgcgatgaaaacagtgaaataggaaccctgacctccccttccatgagaatccagca
gagaatttgctgatgtgttatacatccgggacaatcggaaactgccgttttgattgagta
ttagttgggatgaggagcacataccaggactcccagatctggagtcctcactttctcagc
aagggcacctgcatcctgagcttttacatgtacacacacccagcgattgtgtgtgccgag
aaagacccacatacgcacattgttttttcctcttccacgattatctgccagaattctact
cagttaattgcggtttgagaacacaccatccacaggagagcaccaatggatctagtctag
tgaggttacatttacttgtaatcctcccccttccctttcccatttctttgatgatttttc
ccataagtgtgtaagctactgggacttagtagaagcaggccgctcctcctaaatgtgatt
tggaccatatgctttctacattcattcccgcttcggcttttcttctctgcactaactgct
aacacgttatagtcaccttgaaatttcctctgctattttccaattaaaagcttaatagcc
ctggaaacggagttcatgtggtgaagtttaccacagccccttgttctgaaaggctttctg
ctgggatcccattatgtgcttgaataaaccctttctgcaaacagaaatgggactcggggt
tgtcaggtgttgggttacaatagactttgaggcaggggacattttaccaacataaataca
aacctgtccctatagggagatgttgtcaaatactgggatatggaaaacattcccatcaaa
tatgagaaaaggattactgcactatatcaaatgagtatttagatctcagcccccgatgtg
caccggagtgaaacgggcccccgggaccaaatgccagactgtttgagtggcaacgagata
gggtggctaggtgaccgacgggggaaaaggggtcgccttggtagtgaaagtgcccccaca
aacctggtgcagagctcttctgctttccttttaaaaatttattcatactcaagttcttta
tacttcctcgtttcactgtttgaagaaaatcggaagaaatttggttttgaaaaaagtcgt
tggtccccacgtttccaagagatccggaggtttcagcgcaatagttttcagttaaggtgt
catttgaggccctctatatcgcagcacgttaaatgactcgcgtccagctccccatttcct
agcctcgggcctacagggctgggggcgacctctgcctcccgtccccagagcttacaaaat
tccttccagttgtattttagggcttgttttcctagagaaggttgagactagaggaaggat
taaagtggtgggggaaggggcaagaccgaggggtccctaccccacgcggctttggaggat
ggcctcccagggttagcactcgaatgctagagcttcttgtccacactctaccaggtcagt
gtcccgcgatccccacctcccggacgcgtatgaaacgggaacagctaagggcttcaaggg
aaacacacaactggggttcggttttcaaccctcctctccgcaaatcagccttctgggcag
agggttggctgctagaacgcctggaggtgcttcccttgaattcatggcaaacaccagagg
aaagttttcaggttgcttgcttacttccagggcAGTACAGAGAAAAGCGGCCTC
Primer
(+)GAGAAGCTGACCAGGTGAGAG
(+)GAGGCCGCTTTTCTCTGTACT