Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs1109 ]


Position: chr5:91,940,922-91,942,042 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ARRDC3-AS1 - NR2F1-AS1

Expression Pattern
limb (10 out of 11 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5


Embryo 6


Embryo 8


Fasta sequence
TGTTTGATGCTTAAAACTGTTTAGACTatacagaattacctcctgttcatatgaaacata
tatttcaaagtgcattcattttgtgccccttgtagtgaatcacataatctgaaacaaagc
atggagaaacaaaacaaagaaaaaaagcaaagcaaagaaaaagagaaatgctaaaaagga
aaaaataataattagatgaaacgagtggaggaatagagaaaagtaagcctggtagaaaat
gcaaaagctgcattatctgtatataatgtggctataatactacattggtcagcaactgta
atgtaaaaggtaatgtgtaggagtttttatatgcttttcagaactataaagggagtgtga
gtggattttaaacattttgattagcaccacaaagattttaatgctttatttaaacagttt
gctatagggcaaacacatttggtagacaagtaaaatgaaagcatgggcatccgtttctct
gttttctattaagtaatgttgcgaagtaagcagaagttggattcagatatcagataatta
tctccacactgtgtgtcacagtaaataattttaattggtttaacttcagggaccattact
ggcctaattagaaacatgaaaaggctacaagtattaggaaatatcctgaaggaatgagaa
cattagcaattctgtcaagccatttttaaaataagtacacagtagcagccacatttcagt
gaaaggcaggggacttgaaaggtgcttttaggaaaacagtgcttgtgagcctgtaataag
agaactgtaataggaaccatagaaattgggtaacaggctgacatgtatgctacttctgca
ttaaaaatatactaatcttgttttgattgctgtttttaaaagatgcagattaattttttc
aaaggataaaacaataattgagattggataaatcctgatcaagaatatgttgacttattg
aaggggaaagggatctttgagtaaaatagcttcagctaaacaccttcagcatgcagagat
gtgctgagtgaaggactacactgcgtgtttatttttatttcttcgccttggttttccaac
atacatgagaaacaaataGCTATTATTCTTTGAAGCATGCA
Primer
(+)TGTTTGATGCTTAAAACTGTTTAGACT
(+)TGCATGCTTCAAAGAATAATAGC