Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs110 ]


Position: chr7:21,003,280-21,004,750 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: RPL23P8 - SP4

Timepoints:
e11.5

Publications:

Expression Pattern
forebrain (4 out of 4 embryos) 

Embryo 1


Embryo 2


Embryo 3


 
Sections available
Sections available
Embryo 4


Fasta sequence
GATATAGACATGTGATGGCATCTGtaattccaaccagtcctcaggagaatatccacagat
gcctttttggagccttctctaagataatgaaataggctctggtcagagacactgtacctc
acactgtataacagctttcgacataaatctggagcatgatttgcatttgaaagcaccaga
tcaatatttgaggagggattattttttatcaacttggctctaattctctgaaatatacag
ttattttttaaatgtcaagaccaactacacccacactggcatgaaatagctttgtcaaaa
aagttgaaaaaaattaaacgtaaattttgtgttgacataatccaggttaagtctaaaaaa
gaaaaatacttacttttgtaaaatgagaggctattttatcactcagagaatgtcacatca
attgtaaagccatcaggcccaaggtttggtggtgattgcttcatatttactgttagtcca
gcaacggggatggtacttttacagtctttggacagactagtgagtgtgacatttaaagtg
ttgatttttgcagcacttatgttaattgttgtaattttcctgatgaaccaccattctggt
ttcctgatgcagccaagatagttttacattttctatgcagggcctctttgccatttggtc
tgtgtagtgtcagcttcgagtgctactgaaagcagacaaaattgcaagcaaattgcatca
gattgccaacattgtgaaaaggtaaattgcttgcaaatctatttaaaccactgccctatt
ttcatcagcttcagtacttggtattcatgattgcttaattggcgacctttcctattgtgt
agtgctttatggtgtaatggaaagcgatctttaccaaaccaattaccctttttttctcag
cactacattattgctgtgattgcaactgccagtcctttgtaaatgaactttctgatttca
atgatgtttttaaaatgtaagatagaaaaaagtggcattcatattgtgcgatgttctatt
ttgaagcctctttgtagtcaccattgtctgggaaaatggactgaagggttacacagtacc
tacaaatatccatgtaactattattaatattattataatgtcctcctttgtactgcagct
caattaggaaaggataggagaaatattttgtcaccctgtcaagtgcacaggaagtgcatt
tgaggcttcttttttgacacatacattatctctagtaataagattcgttttaaggagtgg
tgatgaagatacaaaatcaatttaaataaaattcacattgctagttttatggtcactcaa
catttaaaggggagctttaaatgactcaaatattcagacttagaataaaagcttaatttt
aaaagagatagttgtgagcatactaagaaatagtgaatttttaagatcttaggttctgaa
tatacatgCCAAGACACAGCAAAACATGACT
Primer
(+)GATATAGACATGTGATGGCATCTG
(+)AGTCATGTTTTGCTGTGTCTTGG