Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs108 ]


Position: chr16:72,404,533-72,407,591 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: PMFBP1 - ZFHX3

Timepoints:
e11.5

Publications:
Reproducible hindlimb pattern

Expression Pattern
limb (4 out of 4 embryos) 

Embryo 1

Embryo 3

Embryo 4

Fasta sequence
TGCAGGCCATCAAAAAGTAAcaatcaaattgatcagaaatatttacatctaattgttgtt
gcacttcagataagtcacatattctgtgcacacatttattctgagattatacaactactg
tctcagtcatattgacatcagtcttaaacttcattatagcatagccataagtatcaaact
gagaaaacccactcaatggctatagatgatgatgattattctttaccagaatgagaattg
tactgtcacttataacactctgatccaatttcaatcccttctcctacaaactttaaagca
atctcatccagaaatagcagagctggtcagtcttctctagcaggtacttctgccgtttca
ccttttgaggtaagtagcctcagggacatggaaccaattttcaacagtgatttgctacaa
tattgaatacacatctcaataccctcatagatagaagaggagggtgtgattcatcaacac
tttcctttaggtcagcaaacactcaaggaacaattagactgtttacaaagccttggtacc
tggcatagtgcaaagtcaattttaaaaatatattgaatatgtgagcttttccaaattgtc
atcaactgttatgacaagctattaaagaagctattgtagaggactgaagcagcagctgat
ttcaaaacagtaaatcaagtcttggtcaagagcactgatgaaaagagaacaggattcttg
ctgtgtttatgagtggctcaagacagctttaatacacatcaatcacaggtaggcagtgtg
ctctggtctgtgcccccgactctcagcgtgaccttttgtgagtcaccagacggctttcag
gctcggttactcagctgaaaacaaagctaaggagcagaaacctcaatgaaaaacaggcac
tgcatcgctaatgagatttcctggggaaataaattcctcacctctacaaccccctctccc
gacagcccccactctagactgccacgtcccacacattcaagagaaggtgaacaaagtgaa
gtgtttgaggcatgtggttgtgctatcctcccagcttcagaagcatttatcagtaagaat
tcactgtctcactgaaaatagtaaagccacggaaaaagaaatggtcacactatcttgctt
tagaaactagggcactagctttgggttcaaaacctctcaatctgctatggtttgtttaga
gacttgggagaggtggccaatgaatctctcccccccttcaattggttctaaacagtttac
agctgtataaccagtactttgaaatatttccgctccctctaggcaaaagcatttgttatt
gtgaaactttctgctaaaatcataagatcagagttgcacgaaagtgtaacagcttcttag
gagggtgataaaatgggtctggggattgtggcctggattaggaaatgccaccaatttctt
caacttccatagcttcatggtgcaggcggctacatgcggaagaaggaagctctgaaggaa
gtggccgacagaacctatggccctggaaaatgaggcagcacttctttttgcttttaaaat
ttttggccccttgggggttgcactaaccccctaggcctctatctggcacagaggggtctc
ctttctgaggctaggcccgttggaaaggttccacatgactgaaccccactgaatcagtca
gtcaatttagtggctcataagaaaagctgacgatatcatggctccaaggcaggctgccac
cccagagcctcaattgtaactaatgcgggtttaaaagggagatcagaaaatatcatgcag
ataaaatacagagatagaaggaaagaccataacctcaatcggcaaaatgtgatagctttg
tcaaaataaaagccaaagctaaactctcctgctgctgcacacctcccagctcgcgggaac
tgttcacgcagagaggcattttctattagagcaaactcggaaggcagcagggagaaactc
agccataatatctgcacaacagcccctccatgcaaacaccattccagtaatgggaaattt
taatgatgtaaagcagcaaggtcacacgatatgtccaggcagcccttggaaagacactgc
ctcggcagatattacagaggagagctcagaattgctcttggttcattaggctttgcctga
aggttttttcttccactattaactacaaacaaggctgaggttcttattactcagttcctt
gtatgcaatgcaaagaggtgaagggcagggtttgtaaatatggaaaggcagacagcttag
acgtgtttttacaatacttgaaatattctgagtcaccttaaatgtgaaaattgcaaaagc
cttatcaatgttgcagtatttttttcctagcagaactttttatctactcgtgtacagata
aaggtactatatgcacataaatatatacacatggggtggatagattccctcccctccata
cagcaccaccacatcttcttacggtttgcctccttctcccagctttatgaccccattgag
atggctcttactgttttcttcctcgttacattttgatatttcacagcatggcctggattt
cactcccatctccccactccacattattaatgaattggaaagcagacatcattagttttc
ggagaccatttcttttaaaatttacagaccccttcatctgaatccccagagacagtctgc
tgttctcatcttagaatcttattagcatcatatcttctatatcctgccatgcaaactgca
tggctatgcactttctagcacttgacccttttgcggacagaattaatttactctttgaag
atgcagcagcatgctgttgtgcttgttaaagaaagaaaagccaagcaaggatatggcaaa
gcaagcaaagaaattctcagtttaaaagcaagctcttgtaaggcaagttaggtgaagact
gggcagcagaaacaaatagccagtaactattgatggaaataggcaaattagcggattagc
aggaatcgttgggaatttctgcatccaaccactaatgagCATTGGGACAAGCTCCTGAT
Primer
(+)TGCAGGCCATCAAAAAGTAA
(+)ATCAGGAGCTTGTCCCAATG