Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs1043 ]


Position: chr3:147,125,146-147,126,336 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: ZIC4 - ZIC1

Expression Pattern
hindbrain (rhombencephalon) (9 out of 10 embryos) 
neural tube (9 out of 10 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5


Embryo 6

Embryo 7

Embryo 8

Fasta sequence
GAAGACCAGAAAACCAGAAAGGcgaggagcggcggacgctgaccctgccttcctccagcc
cgtgcagtcagcgctggcgtcagggcaaaaaatatattcattttcattttcctctcgctg
gggcacggtgagtttcctaaccgggccgcctatgaaaggatgagttgaggtttctttgtt
tggaaaaagagtttagggctttgattcagctgcaaagaagccaaatgaagttagaaacaa
agggtaaattgaaggattccgactcttggctttttgtgttttccttactagaaaataatt
agacctaatgaatatgcagacgcttcagctaaagcctcggccaggactgctgggttttaa
acagagctgcggagaaatgcaaccttcgtccccacaaccccccgcatccgcgtgcatttt
ttgaaatgcataaatgttgctcggcttaattgattgagtcacagggatttttttttcctg
cttttaagtaccatactcccctacctttcaacaatcattttaatatatagtcaatggctc
tttgtggaagggacaaaaagaaactacgcgcagttgttgaatagactttgcgctaggcaa
agacaggttaatcgagggccgcatcgcgaaaacaagcgagtgttgtatgtttgcactgaa
tccaaatgtctgcattttcctaactaaatcaaagggagtgttatttctttttctgctcac
tcatctgaaggtaagtaaattttctctggcgatcaaaagcctggtcggcaacaaagaccg
cgcccgctttttccaccgtcctggtgtggcgagttgcggaatttcaataactgtgacaag
ggtgactgatttgtgaactagaaaaggtttgaatgtcacaaaatttacattggtcctatc
tattggggatttaaataccgaaaaagtattcggggatctctagggagctttgggcagccc
aagggaacaatagcgcgttgggaaatttacagttttacctgaatgaaaggggcccaagta
gggaacaggagtgaggagagacagggttagcgggggcagtcgaaggagacaacggaaagg
cagaaaacagaaaaataacgcaagagagagaaaaagtaaaggaaactggcaacaacgttt
caaatttgccattaaaaaattcaaacctcAATAACCTGGGAACTTAAGCGC
Primer
(+)GAAGACCAGAAAACCAGAAAGG
(+)GCGCTTAAGTTCCCAGGTTATT