Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs1020 ]


Position: chr18:75,496,338-75,498,507 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: GALR1 - LINC01029

Expression Pattern
hindbrain (rhombencephalon) (8 out of 9 embryos) 
neural tube (4 out of 9 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Fasta sequence
TGCAAAAGAAACGAGTTTTGCTgtattttcgtgtcgcatgaagcattcatttctattcct
tacagctagcagcattttctgttcaattaaagggagaacagcagctcacaaagaaggcag
cacttccttccagaacttggagaaggagcttacaaattgctccatcaaggcccgcagcag
ccttgacaggttcttctttactcagagtggggaggaaggtaaggtttgatataatactct
ctttaaaatcctgagtgaataaagtagtcttgagagaaagtttccagatatagattacct
ataaaaagaataaaagggatgagcattgaagatttttcgtcgccgtaaacaaataatttg
tgatcgctgtacactcaaaccacaaacagaaccaagaattagaagtacccctagctgacc
agcatgtgcgtatatcatcggtctggtgtaatgaagattgcctgataaagatcgcaatat
gacagttttccttttgccttggctgctgaacagccagaaacggttttctgcggccggcca
gctattgatccagctctctcttgtcagtgatgcagttaatgggaattccacaggcaaata
aaagctacattttgtcttcattttcatctgaaatatgagctggtcctttgtactctagac
agtcatttattactcattttcctttattgatgtttatgagctgaggcataaaatgattct
caaatgtagtttaattgaggcatcggttgacactgtaaccatgattaccgatgcgccatc
agcagcgtggagcccatgaatcaaggtttgcttttcattggtcttggaggcagcacgcgg
gagagagtatccttagaaagcaactgggctggagctaaagaaatatgtcgatttatcttc
ataggtagcgagagggaaaggagtctccccagtcctcatccggcagccacatagaggcca
agtgttcccgggcacctggcatccaacggctcgctttcctaggatgggaacgttcttctg
aaacagaatcctattattggtttttaaaatattttcagcctaatgattaaccttaaaaat
cacacgagaaagtgctgccagacacagccaatacacagcaagatggggaggcccagtcct
tcaattcattcgtaaaatggtgagaacaatcaatgcggggagaagtattttttatatgca
gttattaactcataagctacagtatatctcatctcatttcgacaacagctgaggtctcca
tctccccctggagacccctgcaggtcccattatgagaatcataaataatatgtgctaatg
agatatgaattgattatgttggaaaagctgacattttcatccatcattctaaatgatgtt
taacaatggattaccagccagtaattcctctgatatgagattaaataaaatagccggctg
tttcagcaggctagctcaaggagatggcaataaatctgctcaattactgtattaccaatc
cgtttttcactgctaaggatattattatttcatttagacttgttcatgcatcatagatta
ttttatttcaggcagtcaatgggagaaaccgcagcgttttattcactgagccacggagca
gtggctttgcccgagtacagtaaatgtctctccgtgggccccaaacgccccgaggagagg
ccacccagctgcccctgggctgaatgggcaacgtgcaagacacattttagaaagaagcat
tttgcttttaacctaattttctttacttatctgaaaagtctcaaccgaaggatactgcct
aagaaactgatcgattgaaacaagattattagatcctctaagatgatttggtcttcatct
caatcctgtagtagattgagaattagatcacagggactatcctttggcctggaaaattag
attagcagccactgcaatacaaagggtggcctttctcccctgtgcccaacaaacaaacaa
cacatacactctattgatgagaaaagtggattggcaggaagcatttccctggccctccca
gcatcattcaccatttctgacaaccctaatgaagttttgtgactgcattcagtgattgtc
tataagagtaaaataaaagagggatgaattatcctaaaactaagagtTCATCAATTCATT
CCATCATTCA
Primer
(+)TGCAAAAGAAACGAGTTTTGCT
(+)TGAATGATGGAATGAATTGATGA