Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs101 ]


Position: chr16:48,912,816-48,914,144 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: N4BP1 - CBLN1

Timepoints:
e11.5

Publications:

Expression Pattern
hindbrain (rhombencephalon) (3 out of 3 embryos) 

Embryo 1


Embryo 2


Embryo 3

Fasta sequence
CctCATACCTCCAAAGCCTCCAAggcattccatggagccataattgacactctggagtgt
cagttctccaagcccagttcctgagcacagacacaagcctttggaagcctgactggcagc
tcctccaccttgacagcaccatgtgctttagggtgggtgcccccaccattgcttcacctc
accctgtgcccaagagtccaggttcctgctgggcaaaaccaggcgtttcctattattctt
gaatacagcatgaaggatggctggctgccctgccaggaacaatttgattcttccttgtta
gtttttcattaggatttttgttggcttttcttttaaacaatttcttgggtttctttcaag
gtcgaggagaaggatgctgatataaatataccactgagggagggaggagagccccaccct
aatcaaatttgagcaaagacaggataaaaattaaccttcatttgaatatgtaaacaaaca
tggcatttggtaatttccagccgtccttggcttgggttgccaaagagcagcataaagtga
tttgtctgccaggtctctgtacagagaaaaactttattcttagaggctttttacacttga
ataagtgctaaataataataataggccaagactgaaagcaactctttctattggaagggt
gtcaacacaggcaggatgaagaactgggacttcttcaagggagtgagggagtgacaaaat
ctgggttgataaatgctgacattctgaataaaatcactccatgccttcacctaggtcaag
aaacgacattgttttcctgagcggcagtgacagcgaggtgacagagattaatagcttggt
attgactgagcaacttcgagttccttatctctgtcaagtcaaggctgtgtccaagggctg
aaagtgttattagacttataattgcaaagacatttaaagggtttccccttaagggactat
gaaatccaataaacgtttcacaaaacctcaagcgctcgagtgcaaagcccccatctggga
gagctgcgtgctcccagccaagcgccagggaaacctttaagccgccaacattgaataatg
tttgatttatgaagttggttttgaatttgtatcagttgttttattaaaaatatatgaaag
gaagttttaaatatgagcaagccctgtaggctgtcgcctgcactgtgccacctgtctggc
taagccgcctccttcttcctcactctgccgctcagacccaggaggatggaggagctacac
aaacagtgtggctaatttgcggggttaatttggtctgccagggattaagTCTGAATTTTT
CACCTGGGC
Primer
(+)CACCATACCTCCAAAGCCTCCAA
(+)GCCCAGGTGAAAAATTCAGA