Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs10 ]


Position: chr16:78,832,182-78,833,595 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: WWOX - MAF

Timepoints:

Publications:

This sequence did not show observable enhancer activities at E11.5
We define a negative enhancer at this developmental stage when at least 3 transgenics were obtained and yet no reproducible pattern of expression was observed. This does not mean that this sequence is not an enhancer at another time point or a weak enhancer at this time point but below the detectable range at our level of resolution.


Fasta sequence
GGCTCAGATTGACGCTTTTCaagagagagaaaaaaaaagaaaaaaatcttgcctttccct
agctagaggtcagatgtcaaaaaagctaataacacaacccaaggatgtcatcgacaaatg
aaaaaactggtgcgatgcgggaacaaaagctattttatcattaatatgccgcttttttgt
tatgtactcatgccccagaaattattgtacagcctgtacttgagtccttagacagaaagc
atcttatcattcacaagcttagctatgcaatatattcctccctccccccaaggtagttgt
tgttgggttttttttttttttttaagagatttacagtgatctttccatataggtttttct
cgaaacatatatatttttaatttctcaccatctcaggggtaaataaatatattaaaataa
gctatgggatgtacagcagagtataacaatgataaatgatgttgtgtgtaatttttctac
tattaacataaagtaatataaactgaaggacactggtctattgagagacttagaagctaa
tgttccatatcagatgcggccaatgtcaggactgaatacagattaggcagtgtccttttc
tccccaggggaattaaagtttgagacaccacttgctgccagtggttttatggcattttgt
tggggccggtggtgcctttcttggtctattaattcaggagccgtaaacaacaatgtgagc
aaaatgcttttccggtgggatgcatttcatttatatgtgcttgtatcgtctataccttgt
caatccattttgtcacaataagtgtttttaaattgtgtagattacctccacttcattatg
gttcctggcatttgtgtcttatgcaaggctattatgtgaagttaggaaatatttaaaact
ctgcctttctaaagaaacagggacacggtgcagaaaagttcatctggagttaggcttgtg
tcttgccgtctctttaacggagagttcatgggcagggtacagtctgtgagaaggaatgaa
aaccccagggtagatgctaacaaaaatcacttttaaaaaatgtatggtgtccatctgggt
tagcaaacacatgctcacacgtctgtgcttgctggatttttaagaacttaccagcattta
aggttttcttatgaaactgattttactcaccagggatagagtctcaaagttggaggtatt
ttatgttgttttaaataatatcgtcatcacatgtcattttagaccccaaaagtccactcc
gaatctctgcgtatggaattgaggaggggtgaggctgtcagaagccgagggacttggcca
aggtcacatggctttggacggccccctgaaccttggagctcatgttctgtggcactttgc
atactgacctttctGCTCTTTTATGCTGCCTGCT
Primer
(+)GGCTCAGATTGACGCTTTTC
(+)AGCAGGCAGCATAAAAGAGC