Vista Enhancer Logo
Enhancer Browser banner
Vista Logo

Human element [ hs1 ]


Position: chr16:86,430,087-86,430,726 (UCSC browser)
Source: Lawrence Berkeley National Laboratory

Flanking genes: LINC00917 - FENDRR

Timepoints:
e11.5

Publications:

Expression Pattern
cranial nerve (8 out of 12 embryos) 
hindbrain (rhombencephalon) (12 out of 12 embryos) 
limb (3 out of 12 embryos) 
neural tube (12 out of 12 embryos) 

Embryo 1


Embryo 2


Embryo 3


Embryo 4


Embryo 5


Embryo 6


Embryo 7


Embryo 8


Fasta sequence
AACTGAAGGGACCCCGTTAGCATAtaaacaaaaggtggggggtagccccgagcctcttct
ctgacagccagtggcggcagtgatgaatttgtgaagttatctaattttccactgttttaa
ttagagacttgggctctgaggcctcgcagctggcttctttgtgctgtattctgttgcctg
acagagaaaaatgtctcctgtaacgtcagccaagctctccgccagacctgagcaagcgaa
acttctgggattcataaacttgtggtttctgggtagagtggcgtttaaaccaggactcag
tggggaaagggcaacatggccagctcttctccccagcgaatcctcggaaccaaggttggg
gtccaccatcatcgaaggggtgctgcggaaaaggcacggcccagaaagccccctgaggat
tgttctgggggtccttgatcctagtccatgtgaaatggagtctccttgtggcatgtaatt
gagcccagcttagaaaggccagtgctctgcttctccgagacagtgcctttgattgcagag
tgtgtgatctgagtaatttaatttatcgctcatcttttgccaagtgatctttttacaatg
ctgcatttaatgactcCACAGCTGGGGTAGAGGCTCTCCT
Primer
(+)AACTGAAGGGACCCCGTTAGCATA
(+)AGGAGAGCCTCTACCCCAGCTGTG